Editions Ecce Terra CAMPARIS electron GFP microprobe facility Microscopie Confocale

Laboratoire de Microsondes Chromogenic in situ hybridization (CISH) – Microscope Electronique à Balayage


Invivogen Lta-Sa

Lab Reagents

Human IgG antibody Laboratories manufactures the invivogen lta-sa reagents distributed by Genprice. The Invivogen Lta-Sa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact InVivoGen. Other Invivogen products are available in stock. Specificity: Invivogen Category: Lta-Sa

Chemicals information


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LTA Antibody

ABD6453 100 ug
EUR 438


abx085045-10kDa1g 10 kDa; 1 g
EUR 398
  • Shipped within 5-10 working days.


abx085045-1kDa1g 1 kDa; 1 g
EUR 398
  • Shipped within 5-10 working days.


abx085045-20kDa1g 20 kDa; 1 g
EUR 398
  • Shipped within 5-10 working days.

Anti-S. epidermidis LTA (Pagibaximab)-MC-Vc-PAB-DMEA-(PEG2)-duocarmycin SA ADC

ADC-W-2263 1mg Ask for price
Description: This ADC product is comprised of an anti-S


  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Lipoteichoic acid (LTA)

1600-001 5mg
EUR 192
  • Related to: Staphylococcus
  • Applications: ELISA

LTA Blocking Peptide

DF6453-BP 1mg
EUR 195

LTA Conjugated Antibody

C35964 100ul
EUR 397

LTA cloning plasmid

CSB-CL013218HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: atgacaccacctgaacgtctcttcctcccaagggtgcgtggcaccaccctacacctcctccttctggggctgctgctggttctgctgcctggggcccaggggctccctggtgttggcctcacaccttcagctgcccagactgcccgtcagcaccccaagatgcatcttgcccacag
  • Show more
Description: A cloning plasmid for the LTA gene.

Recent Posts

December 2021

