Lab Reagents
Human IgG antibody Laboratories manufactures the pam 3csk4 reagents distributed by Genprice. The Pam 3Csk4 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact InVivoGen. Other Pam products are available in stock. Specificity: Pam Category: 3Csk4
Chemicals information
PAM antibody |
70R-7168 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PAM antibody raised against the N terminal of PAM |
PAM siRNA |
20-abx903833 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAM siRNA |
20-abx927671 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAM siRNA |
20-abx927672 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAM Blocking Peptide |
33R-7169 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAM antibody, catalog no. 70R-7168 |
PAM Blocking Peptide |
DF8228-BP |
Affbiotech |
1mg |
EUR 195 |
PAM Conjugated Antibody |
C45245 |
SAB |
100ul |
EUR 397 |
PAM cloning plasmid |
CSB-CL017417HU-10ug |
Cusabio |
10ug |
EUR 838 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2601
- Sequence: atggctggccgcgtccctagcctgctagttctccttgtttttccaagcagctgtttggctttccgaagcccactttctgtctttaagaggtttaaagaaactaccagaccattttccaatgaatgtcttggtaccaccagacccgtagttcctattgattcatcagattttgcat
- Show more
|
Description: A cloning plasmid for the PAM gene. |
PAM Polyclonal Antibody |
A68647 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
PAM Rabbit pAb |
A15077-100ul |
Abclonal |
100 ul |
EUR 308 |
PAM Rabbit pAb |
A15077-200ul |
Abclonal |
200 ul |
EUR 459 |
PAM Rabbit pAb |
A15077-20ul |
Abclonal |
20 ul |
EUR 183 |
PAM Rabbit pAb |
A15077-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-PAM antibody |
STJ117271 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a multifunctional protein. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme includes two domains with distinct catalytic activities, a peptidylglycine alpha-hydroxylating monooxygenase (PHM) domain and a peptidyl-alpha-hydroxyglycine alpha-amidating lyase (PAL) domain. These catalytic domains work sequentially to catalyze the conversion of neuroendocrine peptides to active alpha-amidated products. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. |