Lab Reagents

Human IgG antibody Laboratories manufactures the pam 3csk4 reagents distributed by Genprice. The Pam 3Csk4 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact InVivoGen. Other Pam products are available in stock. Specificity: Pam Category: 3Csk4

Chemicals information

PAM Antibody
ABD8228	Lifescience Market	100 ug	EUR 438

PAM Antibody
45245-100ul	SAB	100ul	EUR 252

PAM Antibody
45245-50ul	SAB	50ul	EUR 187

PAM Antibody
DF8228	Affbiotech	200ul	EUR 304
Description: PAM Antibody detects endogenous levels of total PAM.

PAM Antibody
1-CSB-PA017417LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAM. Recognizes PAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200

PAM Conjugated Antibody
C45245	SAB	100ul	EUR 397

PAM cloning plasmid
CSB-CL017417HU-10ug	Cusabio	10ug	EUR 838
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2601 Sequence: atggctggccgcgtccctagcctgctagttctccttgtttttccaagcagctgtttggctttccgaagcccactttctgtctttaagaggtttaaagaaactaccagaccattttccaatgaatgtcttggtaccaccagacccgtagttcctattgattcatcagattttgcat Show more
Description: A cloning plasmid for the PAM gene.

PAM Rabbit pAb
A15077-100ul	Abclonal	100 ul	EUR 308

PAM Rabbit pAb
A15077-200ul	Abclonal	200 ul	EUR 459

PAM Rabbit pAb
A15077-20ul	Abclonal	20 ul	EUR 183

PAM Rabbit pAb
A15077-50ul	Abclonal	50 ul	EUR 223

PAM Polyclonal Antibody
A68647	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

PAM Blocking Peptide
33R-7169	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAM antibody, catalog no. 70R-7168

PAM Blocking Peptide
DF8228-BP	Affbiotech	1mg	EUR 195

pCMV-SPORT6-PAM
PVT19159	Lifescience Market	2 ug	EUR 258

pCMV-SPORT6-PAM
PVT13745	Lifescience Market	2 ug	EUR 391

Anti-PAM antibody
STJ117271	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a multifunctional protein. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme includes two domains with distinct catalytic activities, a peptidylglycine alpha-hydroxylating monooxygenase (PHM) domain and a peptidyl-alpha-hydroxyglycine alpha-amidating lyase (PAL) domain. These catalytic domains work sequentially to catalyze the conversion of neuroendocrine peptides to active alpha-amidated products. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.