Editions Ecce Terra CAMPARIS electron GFP microprobe facility Microscopie Confocale

Laboratoire de Microsondes Chromogenic in situ hybridization (CISH) – Microscope Electronique à Balayage

fallback-image

Pam 3Csk4

Lab Reagents

Human IgG antibody Laboratories manufactures the pam 3csk4 reagents distributed by Genprice. The Pam 3Csk4 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact InVivoGen. Other Pam products are available in stock. Specificity: Pam Category: 3Csk4

Chemicals information

PAM antibody

70R-7168 50 ug
EUR 467
Description: Rabbit polyclonal PAM antibody raised against the N terminal of PAM

PAM siRNA

20-abx903833
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PAM siRNA

20-abx927671
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PAM siRNA

20-abx927672
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PAM Antibody

ABD8228 100 ug
EUR 438

PAM Blocking Peptide

33R-7169 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAM antibody, catalog no. 70R-7168

PAM Blocking Peptide

DF8228-BP 1mg
EUR 195

PAM Conjugated Antibody

C45245 100ul
EUR 397

PAM cloning plasmid

CSB-CL017417HU-10ug 10ug
EUR 838
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2601
  • Sequence: atggctggccgcgtccctagcctgctagttctccttgtttttccaagcagctgtttggctttccgaagcccactttctgtctttaagaggtttaaagaaactaccagaccattttccaatgaatgtcttggtaccaccagacccgtagttcctattgattcatcagattttgcat
  • Show more
Description: A cloning plasmid for the PAM gene.

PAM Polyclonal Antibody

A68647 100 ?g
EUR 628.55
Description: kits suitable for this type of research

PAM Rabbit pAb

A15077-100ul 100 ul
EUR 308

PAM Rabbit pAb

A15077-200ul 200 ul
EUR 459

PAM Rabbit pAb

A15077-20ul 20 ul
EUR 183

PAM Rabbit pAb

A15077-50ul 50 ul
EUR 223

pCMV-SPORT6-PAM

PVT13745 2 ug
EUR 391

pCMV-SPORT6-PAM

PVT19159 2 ug
EUR 258

Anti-PAM antibody

STJ117271 100 µl
EUR 277
Description: This gene encodes a multifunctional protein. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme includes two domains with distinct catalytic activities, a peptidylglycine alpha-hydroxylating monooxygenase (PHM) domain and a peptidyl-alpha-hydroxyglycine alpha-amidating lyase (PAL) domain. These catalytic domains work sequentially to catalyze the conversion of neuroendocrine peptides to active alpha-amidated products. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.

Recent Posts

December 2021
M T W T F S S
 12345
6789101112
13141516171819
20212223242526
2728293031  

Categories

Tags